Principles of Genome Analysis and Genomics

Principles of Genome Analysis and Genomics

4.11 - 1251 ratings - Source

With the first draft of the human genome project in the public domain and full analyses of model genomes now available, the subject matter of 'Principles of Genome Analysis and Genomics' is even 'hotter' now than when the first two editions were published in 1995 and 1998. In the new edition of this very practical guide to the different techniques and theory behind genomes and genome analysis, Sandy Primrose and new author Richard Twyman provide a fresh look at this topic. In the light of recent exciting advancements in the field, the authors have completely revised and rewritten many parts of the new edition with the addition of five new chapters. Aimed at upper level students, it is essential that in this extremely fast moving topic area the text is up to date and relevant. Completely revised new edition of an established textbook. Features new chapters and examples from exciting new research in genomics, including the human genome project. Excellent new co-author in Richard Twyman, also co-author of the new edition of hugely popular Principles of Gene Manipulation. Accompanying web-page to help students deal with this difficult topic at TT Signal probe 1 U8 U5 U3 U1 5a#39; CGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTTCTTCGCTT AGAAAGGAAGGAAAGAAGCGAAG M13mp18 target DNA 3a#39; 3a#39; ACT TGA ATA TAT GAA CTT AAA TTT ATT TAA. seen in ... Problems with the PCR in the detection of STSs and SNPs There are a number of problems associated with the use of the PCR in the detection of STSs and SNPs.

Title:Principles of Genome Analysis and Genomics
Author:Sandy B. Primrose, Richard Twyman
Publisher:John Wiley & Sons - 2009-04-01


You Must CONTINUE and create a free account to access unlimited downloads & streaming